regex - For a set of sequences store sequence in hash and its open reading frames as values -


as follow (find multiple matches of , nucleotide sequence)

i want add each orf (as atg...tag or atg...taa) hash each sequence sequence have orfs attached values. have far -

#!/usr/bin/perl use warnings; use strict;  @file = qw(atgccccccccccccctagatgaaaaaaaaaataaatgaaaaatagatgccccccccccccccc atgcgcgctatatatgcgcgggctaatatat atatgaggtcgtagctagcaaacacaaataaa );  %hash; foreach (@file){ @match = ($_ =~ /(atg\w+?ta[ag])/g);  # make %hash sequence key , orfs values)...  } 

can me?

building on code: (i've changed nucleotide sequence make easier see stop , start codons, but work same way sequences...) i've stored matched sequences in array within hash of arrays follows:

#!/usr/bin/perl use warnings; use strict; use data::dumper;  @file = qw(atgcgcgcgcgcgcgtaaatgatatatatatatag atgccccccccctaagggggggggatgttttttttttttag atatgaggggatagaaaatttttttctttct);  (@match, %hash, @sequence, $line); $line_number = 0; foreach  (@file){     push @match, /(atg\w+?ta[ag])/g;         push @sequence, @file 0 .. $#match;  }  push @ { $hash{$sequence[$_]}}, [$match[$_] ] 0 .. $#match; # hasho of arrays  $key (sort keys %hash){         $orf (@ { $hash{$key}}){             ($match) = @$orf;             print "sequence:$key contains orfs: $match\n";     } } 

output:

sequence:atgccccccccctaagggggggggatgttttttttttttag contains orfs: atgatatatatatatag sequence:atgccccccccctaagggggggggatgttttttttttttag contains orfs: atgaggggatag sequence:atgcgcgcgcgcgcgtaaatgatatatatatatag contains orfs: atgcgcgcgcgcgcgtaa sequence:atgcgcgcgcgcgcgtaaatgatatatatatatag contains orfs: atgttttttttttttag sequence:atatgaggggatagaaaatttttttctttct contains orfs: atgccccccccctaa 

Comments

Popular posts from this blog

html - How to style widget with post count different than without post count -

How to remove text and logo OR add Overflow on Android ActionBar using AppCompat on API 8? -

mysql - Pass value between different pages (form) with PHP -